à£à£Ö±²¥Ðã

CRISPR-based genome editing of grain size regulators for novel variation to increase wheat genetic yield potential

• PD: Wanlong Li Institution: South à£à£Ö±²¥Ðã State University
• Co-PD: Bing Yang Institution: Iowa State University

Grain size (GS) is the major driver for further growth of wheat yield. Much progress has been made in dissecting the genetic network regulating GS in the model plants rice and Arabidopsis, wherein more than half of the underlying genes are negative GS regulators or negatively regulated by microRNAs. But little is known about GS regulation in wheat. This knowledge gap significantly limits our effort to improve wheat yield. Hypothesizing that conserved genetic pathways underlie GS variation in rice and wheat, we teamed up with expertise in wheat genetics/genomics and genome editing to address Area Priority 1 of this NIFA-IWYP program (A1142) by creating novel variation of the negative GS regulators using CRISPR-based technology for significant increase of genetic yield potential. Our objectives include:

1. Develop an improved CRISPR/Cas9 system for editing GS candidate genes.
2. Identify mutations in the GS candidate genes.
3. Characterize the effect of mutations on GS.
4. Transfer beneficial mutations into elite durum wheat.

We have optimized the CRISPR/Cas9 system for high-efficiency genome editing in wheat, identified 32 GS candidate genes in wheat genome, and set up platforms for high-throughput GS phenotyping and for early-stage mutation detection. We expect to develop an improved CRIPSR/Cas9 system for wheat with enhanced editing efficiency, targeting flexibility and accuracy, a panel of novel GS mutations and associated knowledge, a package of novel germplasm with enhanced grain yield potential and functional markers. Thus, this project will significantly contribute to IWYP’s goal to increase wheat yield by 50% by 2034.

Primers used in this study

You can download all the above sequences as a .

Dissecting the sea wheatgrass genome to transfer biotic stress resistance and abiotic stress tolerance into wheat.

• PD: Li, Wanlong (South à£à£Ö±²¥Ðã State University, Brookings, SD)
• Co-PD: Xu, Steven S. (USDA-ARS, Fargo, ND)
• Co-PD: Langham, Marie A. C. (South à£à£Ö±²¥Ðã State University, Brookings, SD)
• Co-PD: Ma, Qin (South à£à£Ö±²¥Ðã State University, Brookings, SD)

Wheat production is facing numerous challenges from biotic and abiotic stresses. Alien gene transfer has been an effective approach for wheat germplasm enhancement. Sea wheatgrass (SWG) is a distant relative of wheat and a relatively untapped source for wheat improvement. We have identified high tolerance to waterlogging, manganese toxicity, salinity, heat and low nitrogen and resistance to wheat streak mosaic virus (temperature-insensitive), Fusarium head blight and sawflies (due to solid stem) in SWG and developed a large number of SWG-derived populations.

To facilitate simultaneous discovery and transfer of quantitative trait loci (QTL) for biotic stress resistance and abiotic stress tolerance more efficiently, we propose to dissect the SWG genome with three objectives:

1. Develop a draft SWG genome assembly and genome-specific markers,
2. Dissect SWG chromosomes into RobTs and localize agriculturally important genes and QTL, and
3. Dissect SWG chromosome arms by homoeologous recombination and select sub-arm introgressions of biotic stress resistance and abiotic stress tolerance.

This project addresses the Program Area Priorities of A1141 and NIFA-Kansas Wheat Commission co-fund and will serve our long-term goal to broaden the wheat genetic basis and develop novel germplasm that will contribute to a more sustainable wheat industry.

We are a team of interdisciplinary expertise in cytogenetics, molecular genetics, genomics, bioinformatics, plant breeding and pathology, and have materials, technologies and resources in place as evidenced from strong preliminary results. We expect to deliver a complete package of novel germplasm and associated resources, tools and knowledge for breeding wheat tolerance to abiotic and biotic stress.

Develop novel germplasm with high yield potential and high nitrogen use efficiency by prime editing of growth regulation factor genes in wheat

Non-Technical Summary

Semi-dwarf wheat made the Green Revolution a great success via resistance to yield-reducing lodging. However, the dwarf gene also reduced N use efficiency (NUE), which is also compromised due to increased CO₂ levels. An increase in N fertilizer input not only increases wheat production costs but can also damage our environment due to water pollution. New semi-dwarf wheat varieties combining high yield potential and high NUE are urgently needed to sustainably meet the increasing demand for wheat grains.

This project takes advantage of the recently developed precision genome technologies to modify the N modulator GRF4 to increase NUE and grain yield. The project includes three specific objectives: 1) create synonymous mutations to over-express GRF4, 2) evaluate the mutation effect on yield components and NUE, and 3) develop breeding-ready germplasm. We have developed a mutation which changed the gene sequence but not the protein sequence in GRF4. This mutation enhanced the gene expression by ~ four-fold, made the plants flower 3 – 4 days earlier, increased grain number per spike by 11%, and nitrogen uptake efficiency by two-fold. The mutation has been transferred into elite wheat cultivars and can be used as new germplasm, thus contributing to a more profitable and sustainable US wheat industry and rural economy.

Guide RNA gene sequence

CAACCGTTCAAGAAAGCCTG

Donor DNA sequence

WL7203
[phos]C*T*GTGGACGGACGGCAAGAAGTGGCGGTGCTCCAAGGAGGCCGCCCAGGACTCCAAGTACTGCGAGCGCCACATGCACCGCGGCCGCAACaggagccgcaa*a*C

WL7204
[phos]G*t*ttgcggctcctGTTGCGGCCGCGGTGCATGTGGCGCTCGCAGTACTTGGAGTCCTGGGCGGCCTCCTTGGAGCACCGCCACTTCTTGCCGTCCGTCCAC*A*G

PCR primers for GRF4-2B mutant detection

WL6776
TTTGGTCCATATGCATGAG

WL7209
TCCACAGGtttgcggctcct